Быстрый заказ

Text Size:AAA

Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human WNT11 Информация о продукте «Клон cDNA»
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Homo sapiens wingless-type MMTV integration site family, member 11 with C terminal His tag.
Синоним гена:WNT11
Участок рестрикции:KpnI + XbaI (6kb + 1.12kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human WNT11 Gene Plasmid Map
Human WNT11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12056-ACGRBS15400
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12056-ACRRBS15400
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12056-CFRBS13340
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12056-CHRBS13340
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12056-CMRBS13340
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12056-CYRBS13340
Человек Wnt11 Джин клон кДНК в вектор клонированияHG12056-GRBS5130
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12056-NFRBS13340
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12056-NHRBS13340
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12056-NMRBS13340
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12056-NYRBS13340
Человек Wnt11 Джин ORF экспрессии кДНК клона плазмидыHG12056-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12056-CH
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human WNT11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.