After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human WNT4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_030761.4
Размер кДНК:1056bp
Описание кДНК:Full length Clone DNA of Homo sapiens wingless-type MMTV integration site family, member 4.
Синоним гена:WNT-4, SERKAL, WNT4
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-WNT4
Участок рестрикции:KpnI + XbaI (6.1kb + 1.06kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human WNT4 Gene Plasmid Map
Human WNT-4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10674-ACGRBS15400
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10674-ACRRBS15400
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10674-CFRBS13340
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10674-CHRBS13340
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10674-CMRBS13340
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10674-CYRBS13340
Человек Wnt4 Джин клон кДНК в вектор клонированияHG10674-MRBS5130
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10674-M-FRBS13340
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10674-NFRBS13340
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10674-NHRBS13340
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10674-NMRBS13340
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10674-NYRBS13340
Человек Wnt4 Джин ORF экспрессии кДНК клона плазмидыHG10674-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10674-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human WNT-4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».