After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human WNT2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003391.2
Размер кДНК:1083bp
Описание кДНК:Full length Clone DNA of Homo sapiens wingless-type MMTV integration site family member 2.
Синоним гена:IRP, INT1L1, WNT2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-WNT2
Участок рестрикции:KpnI + XbaI (6.1kb + 1.08kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human WNT2 Gene Plasmid Map
Human WNT-2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10671-ACGRBS15400
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10671-ACRRBS15400
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10671-CFRBS13340
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10671-CHRBS13340
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10671-CMRBS13340
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10671-CYRBS13340
Человек Wnt2 Джин клон кДНК в вектор клонированияHG10671-MRBS5130
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10671-NFRBS13340
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10671-NHRBS13340
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10671-NMRBS13340
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10671-NYRBS13340
Человек Wnt2 Джин ORF экспрессии кДНК клона плазмидыHG10671-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10671-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human WNT-2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».