WISP1 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

WISP1 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1104 bp
Description
Full length Clone DNA of Human WNT1 inducible signaling pathway protein 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

WISP1 cDNA ORF Clone, Human, C-His tag: Alternative Names

CCN4 cDNA ORF Clone, Human; WISP1c cDNA ORF Clone, Human; WISP1i cDNA ORF Clone, Human; WISP1tc cDNA ORF Clone, Human

WISP1 Background Information

CCN4/Wnt-induced secreted protein 1 (WISP1) is a secreted, cysteine-rich, heparin-binding glycoprotein, belonging to the CCN (CTGF/CYR61/NOV) family of growth factors, and is involved in diverse biological functions such as cell growth, adhesion, migration, angiogenesis, tissue repair, and regulation of extracellular matrix. Members of the CCN family demonstrate high structural homology sharing four conserved cysteine-rich modular domains: a IGFBP (insulin-like growthfactor-binding) domain, a von Willebrand type C domain, a thrombospondin domain and a C-terminal cysteine -knot domain. WISP1 is a putative downstream effector of the Wnt/Frizzled pathway that mediates diversedevelopmental processes, was identified as an oncogene regulated by the Wnt-1-beta-catenin pathway. Thus may contributes to Wnt-1-mediated tumorigenesis and malignance. Expression of WISP1 in some cells results in transformation and tumorigenesis. WISP1 acts to block cell death at a late stage in the p53-mediated apoptosis pathway. It was reported that WISP1 interacts with sulfated glycoconjugates, decorin and biglycan in the ECM of connective tissue, and possibly prevents their inhibitory activity in tumor cell proliferation.
Full Name
WNT1 inducible signaling pathway protein 1
References
  • Su F, et al. (2002) WISP-1 attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. Genes Dev. 16(1): 46-57.
  • Yanagita T, et al. (2007) Expression and physiological role of CCN4/Wnt-induced secreted protein 1 mRNA splicing variants in chondrocytes. FEBS J. 274(7): 1655-65.
  • Wang H, et al. (2009) Nitric oxide increases Wnt-induced secreted protein-1 (WISP-1/CCN4) expression and function in colitis. J Mol Med. 87(4): 435-45.
  • Venkatachalam K, et al. (2009) WISP1, a pro-mitogenic, pro-survival factor, mediates tumor necrosis factor-alpha (TNF-alpha)-stimulated cardiac fibroblast proliferation but inhibits TNF-alpha-induced cardiomyocyte death. J Biol Chem. 284(21): 14414-27.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait