Быстрый заказ

Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human WISP1 Информация о продукте «Клон cDNA»
Размер кДНК:1104bp
Описание кДНК:Full length Clone DNA of Homo sapiens WNT1 inducible signaling pathway protein 1 with C terminal His tag.
Синоним гена:CCN4, WISP1c, WISP1i, WISP1tc, WISP1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10442-ACGRBS16764
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10442-ACRRBS15400
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10442-CFRBS13343
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10442-CHRBS13343
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10442-CMRBS13340
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10442-CYRBS13343
Человек CCN4/WISP1 Джин клон кДНК в вектор клонированияHG10442-MRBS5132
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10442-NFRBS13340
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10442-NHRBS13343
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10442-NMRBS13343
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10442-NYRBS13343
Человек CCN4/WISP1 Джин ORF экспрессии кДНК клона плазмидыHG10442-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CCN4/Wnt-induced secreted protein 1 (WISP1) is a secreted, cysteine-rich, heparin-binding glycoprotein, belonging to the CCN (CTGF/CYR61/NOV) family of growth factors, and is involved in diverse biological functions such as cell growth, adhesion, migration, angiogenesis, tissue repair, and regulation of extracellular matrix. Members of the CCN family demonstrate high structural homology sharing four conserved cysteine-rich modular domains: a IGFBP (insulin-like growthfactor-binding) domain, a von Willebrand type C domain, a thrombospondin domain and a C-terminal cysteine -knot domain. WISP1 is a putative downstream effector of the Wnt/Frizzled pathway that mediates diversedevelopmental processes, was identified as an oncogene regulated by the Wnt-1-beta-catenin pathway. Thus may contributes to Wnt-1-mediated tumorigenesis and malignance. Expression of WISP1 in some cells results in transformation and tumorigenesis. WISP1 acts to block cell death at a late stage in the p53-mediated apoptosis pathway. It was reported that WISP1 interacts with sulfated glycoconjugates, decorin and biglycan in the ECM of connective tissue, and possibly prevents their inhibitory activity in tumor cell proliferation.

  • Su F, et al. (2002) WISP-1 attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. Genes Dev. 16(1): 46-57.
  • Yanagita T, et al. (2007) Expression and physiological role of CCN4/Wnt-induced secreted protein 1 mRNA splicing variants in chondrocytes. FEBS J. 274(7): 1655-65.
  • Wang H, et al. (2009) Nitric oxide increases Wnt-induced secreted protein-1 (WISP-1/CCN4) expression and function in colitis. J Mol Med. 87(4): 435-45.
  • Venkatachalam K, et al. (2009) WISP1, a pro-mitogenic, pro-survival factor, mediates tumor necrosis factor-alpha (TNF-alpha)-stimulated cardiac fibroblast proliferation but inhibits TNF-alpha-induced cardiomyocyte death. J Biol Chem. 284(21): 14414-27.
  • Size / Price
    Каталог: HG10442-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.