WIPI2 cDNA ORF Clone, Human, C-His tag

Cat: HG14898-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All WIPI2 Reagents

CRO Services

Product recommended


All WIPI2 Reagents

WIPI2 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1311 bp
Description
Full length Clone DNA of Human WD repeat domain, phosphoinositide interacting 2 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WIPI2 cDNA ORF Clone, Human, C-His tag Alternative Names

ATG18B cDNA ORF Clone, Human;Atg21 cDNA ORF Clone, Human;CGI-50 cDNA ORF Clone, Human;WIPI-2 cDNA ORF Clone, Human

WIPI2 Background Information

Full Name
WD repeat domain, phosphoinositide interacting 2

WIPI2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
WIPI2 cDNA ORF Clone in Cloning Vector, Mouse MG5A4983-U
WIPI2 cDNA ORF Clone, Mouse, untagged MG5A4983-UT
WIPI2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4983-ACG
WIPI2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4983-ACGLN
WIPI2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4983-ANG
WIPI2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4983-ACR
WIPI2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4983-ANR
WIPI2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4983-CF
WIPI2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4983-NF
WIPI2 cDNA ORF Clone, Mouse, C-His tag MG5A4983-CH
WIPI2 cDNA ORF Clone, Mouse, N-His tag MG5A4983-NH
WIPI2 cDNA ORF Clone, Mouse, C-HA tag MG5A4983-CY
WIPI2 cDNA ORF Clone, Mouse, N-HA tag MG5A4983-NY
WIPI2 cDNA ORF Clone, Mouse, C-Myc tag MG5A4983-CM
WIPI2 cDNA ORF Clone, Mouse, N-Myc tag MG5A4983-NM

WIPI2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
WIPI2 cDNA ORF Clone in Cloning Vector, Human HG14898-G
WIPI2 cDNA ORF Clone, Human, untagged HG14898-UT
WIPI2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14898-ACG
WIPI2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14898-ACGLN
WIPI2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14898-ANG
WIPI2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14898-ACR
WIPI2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14898-ANR
WIPI2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14898-CF
WIPI2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14898-NF
WIPI2 cDNA ORF Clone, Human, N-His tag HG14898-NH
WIPI2 cDNA ORF Clone, Human, C-HA tag HG14898-CY
WIPI2 cDNA ORF Clone, Human, N-HA tag HG14898-NY
WIPI2 cDNA ORF Clone, Human, C-Myc tag HG14898-CM
WIPI2 cDNA ORF Clone, Human, N-Myc tag HG14898-NM
WIPI2 qPCR Primer Pairs, Human HP103527
info info
添加购物车成功! 添加购物车失败!