Быстрый заказ

Text Size:AAA

Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human VWC2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_198570
Размер кДНК:978bp
Описание кДНК:Full length Clone DNA of Homo sapiens von Willebrand factor C domain containing 2 with N terminal Flag tag.
Синоним гена:PSST739, UNQ739
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12071-ACGRBS15396
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12071-ACRRBS15396
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12071-CFRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12071-CHRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12071-CMRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12071-CYRBS13343
Человек VWC2 Джин клон кДНК в вектор клонированияHG12071-GRBS5132
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12071-NFRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12071-NHRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12071-NMRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12071-NYRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмидыHG12071-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Brorin, also known as brain-specific chordin-like protein, von Willebrand factor C domain-containing protein 2 and VWC2, is a secreted protein which contains two VWFC domains. VWC2 / Brorin is a BMP antagonist which may play a role in neural development. It promotes cell adhesion. VWC2 / Brorin is a unique member of the chordin family. It inhibited the activity of bone morphogenetic protein 2 (BMP2) and BMP6 in mouse preosteoblastic MC3T3-E1 cells. Mouse Brorin was predominantly expressed in neural tissues in embryos and also predominantly expressed in the adult brain. In the brain, the expression was detected in neurons, but not glial cells. The neural tissue-specific expression profile of Brorin is quite distinct from that of any other member of the Chordin family. VWC2 / Brorin protein promoted neurogenesis, but not astrogenesis, in mouse neural precursor cells. VWC2 / Brorin is a novel secreted BMP antagonist that potentially plays roles in neural development and functions.

Ссылки
  • Koike,N. et al., 2007, J Biol Chem. 282 (21):15843-50.
  • Elis,S. et al., 2009,Mol Reprod Dev. 76 (11):1043-55.
  • Zhang,J.L. et al., 2010,PLoS One. 5 (9):e12846.
  • Size / Price
    Каталог: HG12071-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».