Быстрый заказ

Text Size:AAA

Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human VWC2 Информация о продукте «Клон cDNA»
Размер кДНК:978bp
Описание кДНК:Full length Clone DNA of Homo sapiens von Willebrand factor C domain containing 2 with C terminal HA tag.
Синоним гена:PSST739, UNQ739
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12071-ACGRBS15396
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12071-ACRRBS15396
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12071-CFRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12071-CHRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12071-CMRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12071-CYRBS13343
Человек VWC2 Джин клон кДНК в вектор клонированияHG12071-GRBS5132
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12071-NFRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12071-NHRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12071-NMRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12071-NYRBS13343
Человек VWC2 Джин ORF экспрессии кДНК клона плазмидыHG12071-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Brorin, also known as brain-specific chordin-like protein, von Willebrand factor C domain-containing protein 2 and VWC2, is a secreted protein which contains two VWFC domains. VWC2 / Brorin is a BMP antagonist which may play a role in neural development. It promotes cell adhesion. VWC2 / Brorin is a unique member of the chordin family. It inhibited the activity of bone morphogenetic protein 2 (BMP2) and BMP6 in mouse preosteoblastic MC3T3-E1 cells. Mouse Brorin was predominantly expressed in neural tissues in embryos and also predominantly expressed in the adult brain. In the brain, the expression was detected in neurons, but not glial cells. The neural tissue-specific expression profile of Brorin is quite distinct from that of any other member of the Chordin family. VWC2 / Brorin protein promoted neurogenesis, but not astrogenesis, in mouse neural precursor cells. VWC2 / Brorin is a novel secreted BMP antagonist that potentially plays roles in neural development and functions.

  • Koike,N. et al., 2007, J Biol Chem. 282 (21):15843-50.
  • Elis,S. et al., 2009,Mol Reprod Dev. 76 (11):1043-55.
  • Zhang,J.L. et al., 2010,PLoS One. 5 (9):e12846.
  • Size / Price
    Каталог: HG12071-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.