Быстрый заказ

Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

  • Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5619
ПаспортОбзорыСвязанные продуктыПротоколы
Человек VSIG8 Информация о продукте «Клон cDNA»
Размер кДНК:1284 bp
Описание кДНК:Full length Clone DNA of Homo sapiens V-set and immunoglobulin domain containing 8 with C terminal Flag tag.
Синоним гена:VSIG8
Участок рестрикции:HindIII + XbaI(6kb+1.28kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with VSIG8 qPCR primers for gene expression analysis, HP104271 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15654-ACGRBS15400
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15654-ACRRBS15400
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15654-CFRBS13340
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15654-CHRBS13340
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15654-CMRBS13340
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15654-CYRBS13340
Человек VSIG8/C1orf204 Джин клон кДНК в вектор клонированияHG15654-GRBS5130
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15654-NFRBS13340
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15654-NHRBS13340
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15654-NMRBS13340
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15654-NYRBS13340
Человек VSIG8/C1orf204 Джин ORF экспрессии кДНК клона плазмидыHG15654-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15654-CF
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Добавить в корзинуЗапрос по оптовому заказу

Datasheet & Documentation

Contact Us
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.