After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human VSIG4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC010525
Размер кДНК:1200bp
Описание кДНК:Full length Clone DNA of Homo sapiens V-set and immunoglobulin domain containing 4 with C terminal Myc tag.
Синоним гена:CRIg, Z39IG, VSIG4
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12163-ACGRBS15400
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12163-ACRRBS15400
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12163-CFRBS13340
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12163-CHRBS13340
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12163-CMRBS13340
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12163-CYRBS13340
Человек VSIG4 Джин клон кДНК в вектор клонированияHG12163-GRBS5130
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12163-G-FRBS13340
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12163-NFRBS13340
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12163-NHRBS13340
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12163-NMRBS13340
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12163-NYRBS13340
Человек VSIG4 Джин ORF экспрессии кДНК клона плазмидыHG12163-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

VSIG4 (V-set and immunoglobulin domain containing 4), also known as complement receptor of the immunoglobulin superfamily (CRIg) and Z39Ig, is a type I  transmembrane glycoprotein. It is a B7 family-related protein and an Ig superfamily member. In contrast to the B7 family members which contain two IgG domains, VSIG4 contains one complete V-type I g domain and a truncated C-type I g domain. VSIG4 is exclusively expressed on tissue resident macrophages and binds to multimers of C3b and iC3b that are covalently attached to particle surfaces. No VSIG4 expression appears to be present in T and B cells. VSIG4 functions as a negative regulator of T cell activation, and may be involved in the maintenance of peripheral T cell tolerance, and is also identified as a potent suppressor of established inflammation. Mouse VSIG4 is synthesized as a 280 amino acid precursor that contains a signal sequence, an V-type I g domain (aa 36-115), one potential N-linked glycosylation site, and a single transmembrane domain. The V-type I g domain of mouse VSIG4 shares 86% and 80% aa sequence identity with the V-type I g domains of rat and human VSIG4, respectively.

Ссылки
  • Vogt, L. et al., 2006, J Clin Invest.116: 2817-2826.
  • Helmy, K. et al., 2006, Cell. 124:915-927.
  • Wiesmann, C. et al., 2006, Nature. 444:217-220.
  • Zang,X. et al., 2006, J Clin Invest. 116: 2590-2593.
  • Katschke, KJ. et al., 2007, J. Exp. Med. 204:1319-1325.
  • He,JQ. et al., 2008, Mol Immunol. 45: 4041-4047.
  • Size / Price
    Каталог: HG12163-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».