VPS25 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

VPS25 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Human vacuolar protein sorting 25 homolog (S. cerevisiae).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

VPS25 cDNA ORF Clone, Human, untagged: Alternative Names

DERP9 cDNA ORF Clone, Human; EAP20 cDNA ORF Clone, Human; FAP20 cDNA ORF Clone, Human

VPS25 Background Information

Full Name
vacuolar protein sorting 25 homolog (S. cerevisiae)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait