After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human VPS25 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_032353.3
Размер кДНК:531bp
Описание кДНК:Full length Clone DNA of Homo sapiens vacuolar protein sorting 25 homolog (S. cerevisiae).
Синоним гена:DERP9, EAP20, FAP20
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16145-ACGRBS15400
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16145-ACRRBS15400
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16145-CFRBS13340
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16145-CHRBS13340
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16145-CMRBS13340
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16145-CYRBS13340
Человек VPS25 Джин клон кДНК в вектор клонированияHG16145-GRBS5130
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16145-NFRBS13340
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16145-NHRBS13340
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16145-NMRBS13340
Человек VPS25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16145-NYRBS13340
Человек VPS25 Джин ORF экспрессии кДНК клона плазмидыHG16145-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16145-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».