After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DUSP3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_004090.3
Размер кДНК:558bp
Описание кДНК:Full length Clone DNA of Homo sapiens dual specificity phosphatase 3 with N terminal His tag.
Синоним гена:DUSP3, VHR
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10114-ACGRBS15400
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10114-ACRRBS15400
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10114-ANGRBS15400
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10114-ANRRBS15400
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10114-CFRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10114-CHRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10114-CMRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10114-CYRBS13340
Человек DUSP3/VHR Джин клон кДНК в вектор клонированияHG10114-MRBS5130
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10114-NFRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10114-NHRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10114-NMRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10114-NYRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмидыHG10114-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

Ссылки
  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Size / Price
    Каталог: HG10114-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».