Быстрый заказ

Text Size:AAA

Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human DUSP3 Информация о продукте «Клон cDNA»
Размер кДНК:558bp
Описание кДНК:Full length Clone DNA of Homo sapiens dual specificity phosphatase 3 with N terminal His tag.
Синоним гена:DUSP3, VHR
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10114-ACGRBS15400
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10114-ACRRBS15400
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10114-ANGRBS15400
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10114-ANRRBS15400
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10114-CFRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10114-CHRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10114-CMRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10114-CYRBS13340
Человек DUSP3/VHR Джин клон кДНК в вектор клонированияHG10114-MRBS5130
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10114-NFRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10114-NHRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10114-NMRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10114-NYRBS13340
Человек DUSP3/VHR Джин ORF экспрессии кДНК клона плазмидыHG10114-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Size / Price
    Каталог: HG10114-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.