After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FLT4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002020.4
Размер кДНК:3897bp
Описание кДНК:Full length Clone DNA of Homo sapiens fms-related tyrosine kinase 4 with N terminal Myc tag.
Синоним гена:PCL, FLT41, LMPH1A, VEGFR3, FLT4
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-FLT4
Участок рестрикции:HindIII + XbaI (6kb + 3.92kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human FLT4 Gene Plasmid Map
Human VEGFR3 / FLT4 natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10806-ACGRBS25660
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10806-ACRRBS25660
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10806-CFRBS23610
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10806-CHRBS23610
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10806-CMRBS23610
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10806-CYRBS23610
Человек VEGFR3/FLT-4 Джин клон кДНК в вектор клонированияHG10806-MRBS5130
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10806-M-YRBS23610
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10806-NFRBS23610
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10806-NHRBS23610
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10806-NMRBS23610
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10806-NYRBS23610
Человек VEGFR3/FLT-4 Джин ORF экспрессии кДНК клона плазмидыHG10806-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Vascular endothelial growth factor receptor 3 (VEGFR3), also known as FLT-4, together with the other two members VEGFR1 (FLT-1) and VEGFR2 (KDR/Flk-1) are receptors for vascular endothelial growth factors (VEGF) and belong to the class III subfamily of receptor tyrosine kinases (RTKs). The VEGFR3 protein is expressed mainly on lymphatic vessels but it is also up-regulated in tumor angiogenesis. Mutations in VEGFR3 have been identified in patients with primary lymphoedema. The VEGF-C/VEGF-D/VEGFR3 signaling pathway may provide a target for antilymphangiogenic therapy in prostate cancer, breast cancer, gastric cancer, lung cancer, non-small cell lung cancer (NSCLC), and so on.

Ссылки
  • Shushanov S, et al. (2000)VEGFc and VEGFR3 expression in human thyroid pathologies. Int J Cancer.86(1): 47-52.
  • Iljin K, et al. (2001) VEGFR3 gene structure, regulatory region, and sequence polymorphisms. FASEB J. 15(6): 1028-36.
  • Liu XE, et al. (2004) Expression and significance of VEGF-C and FLT-4 in gastric cancer. World J Gastroenterol. 10(3): 352-5.
  • Stearns ME, et al. (2004) Expression of a flt-4 (VEGFR3) splicing variant in primary human prostate tumors. VEGF D and flt-4t(Delta773-1081) overexpression is diagnostic for sentinel lymph node metastasis. Lab Invest. 84(6): 785-95.
  • Size / Price
    Каталог: HG10806-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human VEGFR3 / FLT4 natural ORF mammalian expression plasmid, N-Myc tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».