Быстрый заказ

Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FIGF Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_004469.2
    Размер кДНК:1065bp
    Описание кДНК:Full length Clone DNA of Homo sapiens c-fos induced growth factor (vascular endothelial growth factor D) with N terminal Flag tag.
    Синоним гена:VEGFD, VEGF-D
    Виды:Human
    переносчик:pCMV3-SP-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FIGF qPCR primers for gene expression analysis, HP100569 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10557-ACGRBS15400
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10557-ACRRBS15400
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10557-CFRBS13340
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10557-CHRBS13340
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10557-CMRBS13340
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10557-CYRBS13340
    Человек FIGF/VEGF-D Джин клон кДНК в вектор клонированияHG10557-MRBS5130
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10557-M-FRBS13340
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10557-NFRBS13340
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10557-NHRBS13340
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10557-NMRBS13340
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10557-NYRBS13340
    Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмидыHG10557-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Vascular endothelial growth factor D (VEGF-D), also known as C-fos induced growth factor (FIGF), belongs to the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. FIGF protein is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. FIGF protein is secreted as a non-covelent homodimer in an antiparallel fashion. Human FIGF protein is expressed in adult lung, heart, muscle, and small intestine, and is most abundantly expressed in fetal lungs and skin. FIGF protein is structurally and functionally similar to VEGF-C. Therefore, FIGF protein binds and activates VEGFR-2 (Flk1) and VEGFR-3 (Flt4) receptors, and may particularly be involved in cancers, such as breast cancer, epithelial ovarian carcinoma and so on.

    Ссылки
  • Avantaggiato V, et al. (1998) Embryonic expression pattern of the murine figf gene, a growth factor belonging to platelet-derived growth factor/vascular endothelial growth factor family. Mech Dev. 73(2):221-4.
  • Rocchigiani M, et al. (1998) Human FIGF: cloning, gene structure, and mapping to chromosome Xp22.1 between the PIGA and the GRPR genes. Genomics 47(2):207-16.
  • Karpanen T, et al. (2008) VEGF-D: a modifier of embryonic lymphangiogenesis. Blood. 112(5): 1547-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».