Быстрый заказ

Text Size:AAA

Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FIGF Информация о продукте «Клон cDNA»
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Homo sapiens c-fos induced growth factor (vascular endothelial growth factor D) with N terminal Flag tag.
Синоним гена:VEGFD, VEGF-D
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10557-ACGRBS15400
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10557-ACRRBS15400
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10557-CFRBS13340
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10557-CHRBS13340
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10557-CMRBS13340
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10557-CYRBS13340
Человек FIGF/VEGF-D Джин клон кДНК в вектор клонированияHG10557-MRBS5130
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10557-M-FRBS13340
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10557-NFRBS13340
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10557-NHRBS13340
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10557-NMRBS13340
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10557-NYRBS13340
Человек FIGF/VEGF-D Джин ORF экспрессии кДНК клона плазмидыHG10557-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Vascular endothelial growth factor D (VEGF-D), also known as C-fos induced growth factor (FIGF), belongs to the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. FIGF protein is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. FIGF protein is secreted as a non-covelent homodimer in an antiparallel fashion. Human FIGF protein is expressed in adult lung, heart, muscle, and small intestine, and is most abundantly expressed in fetal lungs and skin. FIGF protein is structurally and functionally similar to VEGF-C. Therefore, FIGF protein binds and activates VEGFR-2 (Flk1) and VEGFR-3 (Flt4) receptors, and may particularly be involved in cancers, such as breast cancer, epithelial ovarian carcinoma and so on.

  • Avantaggiato V, et al. (1998) Embryonic expression pattern of the murine figf gene, a growth factor belonging to platelet-derived growth factor/vascular endothelial growth factor family. Mech Dev. 73(2):221-4.
  • Rocchigiani M, et al. (1998) Human FIGF: cloning, gene structure, and mapping to chromosome Xp22.1 between the PIGA and the GRPR genes. Genomics 47(2):207-16.
  • Karpanen T, et al. (2008) VEGF-D: a modifier of embryonic lymphangiogenesis. Blood. 112(5): 1547-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.