After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human VEGFB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003377.3
Размер кДНК:624bp
Описание кДНК:Full length Clone DNA of Homo sapiens vascular endothelial growth factor B with N terminal Flag tag.
Синоним гена:VRF, VEGFL, VEGFB
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-VEGFB
Участок рестрикции:HindIII + XbaI (6kb + 0.65kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human VEGFB Gene Plasmid Map
Human VEGF-B natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10544-ACGRBS15400
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10544-ACRRBS15400
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10544-CFRBS13343
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10544-CHRBS13343
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10544-CMRBS13343
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10544-CYRBS13343
Человек VEGF-B Джин клон кДНК в вектор клонированияHG10544-MRBS5132
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10544-NFRBS13343
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10544-NHRBS13340
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10544-NMRBS13340
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10544-NYRBS13343
Человек VEGF-B Джин ORF экспрессии кДНК клона плазмидыHG10544-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10544-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human VEGF-B natural ORF mammalian expression plasmid, N-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».