After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human VDR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000376.2
Размер кДНК:1284bp
Описание кДНК:Full length Clone DNA of Homo sapiens vitamin D (1,25- dihydroxyvitamin D3) receptor.
Синоним гена:NR1I1, VDR
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12025-ACGRBS15400
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12025-ACRRBS15400
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12025-ANGRBS15400
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12025-ANRRBS15400
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12025-CFRBS13340
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12025-CHRBS13340
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12025-CMRBS13340
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12025-CYRBS13340
Человек VDR-NR111 Джин клон кДНК в вектор клонированияHG12025-GRBS5130
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмидыHG12025-G-NRBS13340
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12025-NFRBS13340
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12025-NHRBS13340
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12025-NMRBS13340
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12025-NYRBS13340
Человек VDR-NR111 Джин ORF экспрессии кДНК клона плазмидыHG12025-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

VDR (vitamin D(1,25- dihydroxyvitamin D3)receptor), also known as NR1I1, belongs to the NR1I family, NR1 subfamily. It is composed of three domains: a modulating N-terminal domain, a DNA-binding domain and a C-terminal ligand-binding domain. Vitamin D receptors (VDRs) are members of the NR1I family, which also includes pregnane X (PXR) and constitutive androstane (CAR) receptors, that form heterodimers with members of the retinoid X receptor family. VDRs repress expression of 1alpha-hydroxylase (the proximal activator of 1,25(OH)2D3) and induce expression of the 1,25(OH)2D3 inactivating enzyme CYP24. Also, it has recently been identified as an additional bile acid receptor alongside FXR and may function to protect gut against the toxic and carcinogenic effects of these endobiotics. VDR is expressed in the intestine, thyroid and kidney and has a vital role in calcium homeostasis. It is the nuclear hormone receptor, also called transcription factor that mediates the action of vitamin D3. Inherited mutations in the VDR gene leads to rickets.

Ссылки
  • Moore DD, et al. (2006) The NR1H and NR1I receptors: constitutive androstane receptor, pregnene X receptor, farnesoid X receptor alpha, farnesoid X receptor beta, liver X receptor alpha, liver X receptor beta, and vitamin D receptor. Pharmacol Rev. 58(4):742-59.
  • Szpirer J, et al. (1991)The Sp1 transcription factor gene (SP1) and the 1,25-dihydroxyvitamin D3 receptor gene (VDR) are colocalized on human chromosome arm 12q and rat chromosome 7. Genomics. 11(1):168-73.
  • Germain P, et al. (2006) Overview of nomenclature of nuclear receptors. Pharmacol Rev. 58(4): 685-704.
  • Adorini L, et al. (2006) Vitamin D receptor agonists, cancer and the immune system: an intricate relationship. Curr Top Med Chem. 6(12):1297-301.
  • Luderer HF, et al. (2010) The vitamin D receptor, the skin and stem cells. J Steroid Biochem Mol Biol. 121(1-2):314-6.
  • Size / Price
    Каталог: HG12025-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».