Быстрый заказ

Text Size:AAA

Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human VAPB Информация о продукте «Клон cDNA»
Размер кДНК:732bp
Описание кДНК:Full length Clone DNA of Homo sapiens VAMP (vesicle-associated membrane protein)-associated protein B and C with N terminal His tag.
Синоним гена:ALS8, VAP-B, VAP-C, VAMP-B, VAMP-C, VAPB
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10754-ACGRBS15400
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10754-ACRRBS15400
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10754-ANGRBS15400
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10754-ANRRBS15400
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10754-CFRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10754-CHRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10754-CMRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10754-CYRBS13340
Человек VAPB/VAP-B Джин клон кДНК в вектор клонированияHG10754-MRBS5130
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10754-M-FRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10754-NFRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10754-NHRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10754-NMRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10754-NYRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмидыHG10754-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Vesicle-associated membrane protein-associated protein B / C, also known as VAMP-B/VAMP-C, VAMP-associated protein B/C, VAP-B/VAP-C and VAPB, is a single-pass type IV membrane protein which belongs to the VAMP-associated protein ( VAP ) family. VAPB contains one MSP domain. VAPB may play a role in vesicle trafficking. VAPB forms a heterodimer with VAPA. VAPB interacts with VAMP1 and VAMP2. Defects in VAPB are the cause of amyotrophic lateral sclerosis type 8 ( ALS8 ) which is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Defects in VAPB are also a cause of spinal muscular atrophy autosomal dominant Finkel type ( SMAF ) which is characterized by proximal muscle weakness that begins in the lower limbs and then progresses to upper limbs.

  • Nishimura Y., et al., 1999, Biochem. Biophys. Res. Commun. 254:21-26.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Hamamoto I., et al., 2005, J. Virol. 79:13473-13482.
  • Choudhary C. et al., 2009, Science 325:834-840.
  • Size / Price
    Каталог: HG10754-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.