After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human VAPB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_004738.3
Размер кДНК:732bp
Описание кДНК:Full length Clone DNA of Homo sapiens VAMP (vesicle-associated membrane protein)-associated protein B and C with N terminal His tag.
Синоним гена:ALS8, VAP-B, VAP-C, VAMP-B, VAMP-C, VAPB
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10754-ACGRBS15400
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10754-ACRRBS15400
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10754-ANGRBS15400
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10754-ANRRBS15400
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10754-CFRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10754-CHRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10754-CMRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10754-CYRBS13340
Человек VAPB/VAP-B Джин клон кДНК в вектор клонированияHG10754-MRBS5130
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10754-M-FRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10754-NFRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10754-NHRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10754-NMRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10754-NYRBS13340
Человек VAPB/VAP-B Джин ORF экспрессии кДНК клона плазмидыHG10754-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Vesicle-associated membrane protein-associated protein B / C, also known as VAMP-B/VAMP-C, VAMP-associated protein B/C, VAP-B/VAP-C and VAPB, is a single-pass type IV membrane protein which belongs to the VAMP-associated protein ( VAP ) family. VAPB contains one MSP domain. VAPB may play a role in vesicle trafficking. VAPB forms a heterodimer with VAPA. VAPB interacts with VAMP1 and VAMP2. Defects in VAPB are the cause of amyotrophic lateral sclerosis type 8 ( ALS8 ) which is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Defects in VAPB are also a cause of spinal muscular atrophy autosomal dominant Finkel type ( SMAF ) which is characterized by proximal muscle weakness that begins in the lower limbs and then progresses to upper limbs.

Ссылки
  • Nishimura Y., et al., 1999, Biochem. Biophys. Res. Commun. 254:21-26.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Hamamoto I., et al., 2005, J. Virol. 79:13473-13482.
  • Choudhary C. et al., 2009, Science 325:834-840.
  • Size / Price
    Каталог: HG10754-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».