After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human USP8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC110590
Размер кДНК:3357bp
Описание кДНК:Full length Clone DNA of Homo sapiens ubiquitin specific peptidase 8 with N terminal His tag.
Синоним гена:UBPY, HumORF8
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15979-ACGRBS22240
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15979-ACRRBS22240
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15979-ANGRBS22240
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15979-ANRRBS22240
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15979-CFRBS20190
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15979-CHRBS20190
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15979-CMRBS20190
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15979-CYRBS20190
Человек USP8 Джин клон кДНК в вектор клонированияHG15979-GRBS5130
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15979-NFRBS20190
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15979-NHRBS20190
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15979-NMRBS20190
Человек USP8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15979-NYRBS20190
Человек USP8 Джин ORF экспрессии кДНК клона плазмидыHG15979-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15979-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».