After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human USH1C Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005709.2
Размер кДНК:1659bp
Описание кДНК:Full length Clone DNA of Homo sapiens Usher syndrome 1C (autosomal recessive, severe), transcript variant 1 with C terminal Myc tag.
Синоним гена:PDZ73, AIE-75, DFNB18, PDZ-45, PDZ-73, NY-CO-37, NY-CO-38, ush1cpst, PDZ-73/NY-CO-38
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10613-ACGRBS16760
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10613-ACRRBS16760
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10613-ANGRBS16760
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10613-ANRRBS16760
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10613-CFRBS14710
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10613-CHRBS14710
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10613-CMRBS14710
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10613-CYRBS14710
Человек USH1C/Harmonin transcript variant 1 Джин клон кДНК в вектор клонированияHG10613-MRBS5130
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10613-M-FRBS14710
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10613-NFRBS14710
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10613-NHRBS14710
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10613-NMRBS14710
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10613-NYRBS14710
Человек USH1C/Harmonin transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10613-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Harmonin, also known as Antigen NY-CO-38 / NY-CO-37, Autoimmune enteropathy-related antigen AIE-75, Protein PDZ-73, Renal carcinoma antigen NY-REN-3, Usher syndrome type-1C protein and USH1C, is a protein which is expressed in small intestine, colon, kidney, eye and weakly in pancreas. USH1C is expressed also in vestibule of the inner ear. USH1C contains 3 PDZ (DHR) domains. USH1C may be involved in protein-protein interaction. Defects in USH1C are the cause of Usher syndrome type 1C (USH1C), also known as Usher syndrome type I Acadian variety. USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa and sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). Defects in USH1C are also the cause of deafness autosomal recessive type 18 (DFNB18) which is a form of sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

Ссылки
  • Verpy, E. et al., 2000, Nat Genet. 26 (1):51-5.
  • Weil D., et al., 2003, Hum. Mol. Genet. 12:463-471.
  • Reiners,J. et al., 2005, Hum Mol Genet. 14 (24):3933-43.
  • Yan,D. et al., 2006, Mol Biol. 357 (3):755-64.
  • Size / Price
    Каталог: HG10613-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».