After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human UQCRC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003365.2
Размер кДНК:1443bp
Описание кДНК:Full length Clone DNA of Homo sapiens ubiquinol-cytochrome c reductase core protein I.
Синоним гена:QCR1, UQCR1, D3S3191
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16163-ACGRBS15400
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16163-ACRRBS15400
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16163-ANGRBS15400
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16163-ANRRBS15400
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16163-CFRBS13340
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16163-CHRBS13340
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16163-CMRBS13340
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16163-CYRBS13340
Человек UQCRC1 Джин клон кДНК в вектор клонированияHG16163-GRBS5130
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16163-NFRBS13340
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16163-NHRBS13340
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16163-NMRBS13340
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16163-NYRBS13340
Человек UQCRC1 Джин ORF экспрессии кДНК клона плазмидыHG16163-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16163-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».