Быстрый заказ

Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек UPK1B Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC063568
    Размер кДНК:783bp
    Описание кДНК:Full length Clone DNA of Homo sapiens uroplakin 1B DNA.
    Синоним гена:UPIB, UPK1, TSPAN20
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with UPK1B qPCR primers for gene expression analysis, HP103873 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15247-ACGRBS15400
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15247-ACRRBS15400
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15247-CFRBS13340
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15247-CHRBS13340
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15247-CMRBS13340
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15247-CYRBS13340
    Человек UPK1B Джин клон кДНК в вектор клонированияHG15247-GRBS5130
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15247-NFRBS13340
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15247-NHRBS13340
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15247-NMRBS13340
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15247-NYRBS13340
    Человек UPK1B Джин ORF экспрессии кДНК клона плазмидыHG15247-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15247-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».