Быстрый заказ

Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human UNC5A Информация о продукте «Клон cDNA»
Размер кДНК:2529bp
Описание кДНК:Full length Clone DNA of Homo sapiens unc-5 homolog A (C. elegans) with C terminal HA tag.
Синоним гена:UNC5H1, UNC5A
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13424-ACGRBS22240
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13424-ACRRBS22240
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13424-CFRBS20190
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13424-CHRBS20190
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13424-CMRBS20190
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13424-CYRBS20190
Человек UNC5A / UNC5H1 Джин клон кДНК в вектор клонированияHG13424-GRBS5130
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13424-G-FRBS20190
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13424-NFRBS20190
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13424-NHRBS20190
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13424-NMRBS20190
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13424-NYRBS20190
Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмидыHG13424-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13424-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.