Быстрый заказ

Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек UNC5A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_133369.2
    Размер кДНК:2529bp
    Описание кДНК:Full length Clone DNA of Homo sapiens unc-5 homolog A (C. elegans) with C terminal HA tag.
    Синоним гена:UNC5H1, UNC5A
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with UNC5A qPCR primers for gene expression analysis, HP102126 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13424-ACGRBS22240
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13424-ACRRBS22240
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13424-CFRBS20190
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13424-CHRBS20190
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13424-CMRBS20190
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13424-CYRBS20190
    Человек UNC5A / UNC5H1 Джин клон кДНК в вектор клонированияHG13424-GRBS5130
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13424-G-FRBS20190
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13424-NFRBS20190
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13424-NHRBS20190
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13424-NMRBS20190
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13424-NYRBS20190
    Человек UNC5A / UNC5H1 Джин ORF экспрессии кДНК клона плазмидыHG13424-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13424-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».