After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ULK1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003565.2
Размер кДНК:3153bp
Описание кДНК:Full length Clone DNA of Homo sapiens unc-51-like kinase 1 (C. elegans).
Синоним гена:ATG1, UNC51, Unc51.1, FLJ38455, FLJ46475, ULK1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12031-ACGRBS22240
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12031-ACRRBS22240
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12031-ANGRBS22240
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12031-ANRRBS22240
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12031-CFRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12031-CHRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12031-CMRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12031-CYRBS20190
Человек ULK1 Джин клон кДНК в вектор клонированияHG12031-GRBS5130
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12031-NFRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12031-NHRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12031-NMRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12031-NYRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмидыHG12031-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12031-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».