Быстрый заказ

Text Size:AAA

Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ULK1 Информация о продукте «Клон cDNA»
Размер кДНК:3153bp
Описание кДНК:Full length Clone DNA of Homo sapiens unc-51-like kinase 1 (C. elegans) with C terminal His tag.
Синоним гена:ATG1, UNC51, Unc51.1, FLJ38455, FLJ46475, ULK1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12031-ACGRBS22240
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12031-ACRRBS22240
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12031-ANGRBS22240
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12031-ANRRBS22240
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12031-CFRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12031-CHRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12031-CMRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12031-CYRBS20190
Человек ULK1 Джин клон кДНК в вектор клонированияHG12031-GRBS5130
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12031-NFRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12031-NHRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12031-NMRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12031-NYRBS20190
Человек ULK1 Джин ORF экспрессии кДНК клона плазмидыHG12031-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.