Быстрый заказ

Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

  • Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5619
ПаспортОбзорыСвязанные продуктыПротоколы
Человек UCHL3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006002.3
Размер кДНК:732 bp
Описание кДНК:Full length Clone DNA of Homo sapiens ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) with C terminal Flag tag.
Синоним гена:UCH-L3, UCHL3
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-UCHL3-Flag
Участок рестрикции:HindIII + XbaI(6kb+0.73kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with UCHL3 qPCR primers for gene expression analysis, HP101443 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11634-ACGRBS15400
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11634-ACRRBS15400
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11634-ANGRBS15400
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11634-ANRRBS15400
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11634-CFRBS13340
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11634-CHRBS13340
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11634-CMRBS13340
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11634-CYRBS13340
Человек UCHL3 Джин клон кДНК в вектор клонированияHG11634-MRBS5130
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11634-M-FRBS13340
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11634-NFRBS13340
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11634-NHRBS13340
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11634-NMRBS13340
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11634-NYRBS13340
Человек UCHL3 Джин ORF экспрессии кДНК клона плазмидыHG11634-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Ubiquitin carboxyl-terminal hydrolase isozyme L3, also known as UCH-L3, Ubiquitin thioesterase L3 and UCHL3, is a ubiquitin-protein hydrolase which belongs to the peptidase C12 family. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of either ubiquitin or NEDD8. UCHL3 is highly expressed in heart, skeletal muscle, and testis. UCHL1 and UCHL3 are two of the deubiquitinating enzymes expressed in the brain. These phenotypes indicate the importance of UCHL1 and UCHL3 in the regulation of the central nervous system. UCHL3 functions as a de-ubiquitinating enzyme where lack of its hydrolase activity may result in the prominent accumulation of ubiquitinated proteins and subsequent induction of stress responses in skeletal muscle. UCHL3 has also been identified as a tumor-specific antigen in colon cancer.

Ссылки
  • Wood,M.A. et al., 2005, Hippocampus  15 (5):610-21.
  • Kwon,J. et al., 2006, Exp Anim  55 (1):35-43.
  • Setsuie,R. et al., 2009, Neurochem Int  54 (5-6):314-21.
  • Setsuie,R. et al., 2010, Neurochem Int  56 (8):911-8.
  • Size / Price
    Каталог: HG11634-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Добавить в корзинуЗапрос по оптовому заказу

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».