Быстрый заказ

Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human UBE3A Информация о продукте «Клон cDNA»
Размер кДНК:2559bp
Описание кДНК:Full length Clone DNA of Homo sapiens ubiquitin protein ligase E3A, transcript variant 1 with C terminal His tag.
Синоним гена:AS, ANCR, E6-AP, HPVE6A, EPVE6AP, FLJ26981, UBE3A
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11130-ACGRBS22240
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11130-ACRRBS22240
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11130-ANGRBS22240
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11130-ANRRBS22240
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11130-CFRBS20190
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11130-CHRBS20190
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11130-CMRBS20190
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11130-CYRBS20190
Человек E6AP transcript variant 1 Джин клон кДНК в вектор клонированияHG11130-MRBS5130
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11130-M-NRBS20190
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11130-NFRBS20190
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11130-NHRBS20190
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11130-NMRBS20190
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11130-NYRBS20190
Человек E6AP transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11130-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11130-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.