Быстрый заказ

Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек UBE2K Информация о продукте «Клон cDNA»
    Размер кДНК:474bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ubiquitin-conjugating enzyme E2K with C terminal Flag tag.
    Синоним гена:LIG, HIP2, HYPG, UBC1, E2-25K
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    ( We provide with UBE2K qPCR primers for gene expression analysis, HP105050 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16296-ACGRBS15400
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16296-ACRRBS15400
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16296-ANGRBS15400
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16296-ANRRBS15400
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16296-CFRBS13340
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16296-CHRBS13340
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16296-CMRBS13340
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16296-CYRBS13340
    Человек UBE2K Джин клон кДНК в вектор клонированияHG16296-GRBS5130
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16296-NFRBS13340
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16296-NHRBS13340
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16296-NMRBS13340
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16296-NYRBS13340
    Человек UBE2K Джин ORF экспрессии кДНК клона плазмидыHG16296-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG16296-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.