UBE2D1 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

UBE2D1 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Human ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

UBE2D1 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

E2(17)KB1 cDNA ORF Clone, Human; SFT cDNA ORF Clone, Human; UBC4/5 cDNA ORF Clone, Human; UBCH5 cDNA ORF Clone, Human; UBCH5A cDNA ORF Clone, Human

UBE2D1 Background Information

Ubiquitin-conjugating enzyme E2 D1 (UBE2D1), a member of human E2 ubiquitin-conjugating enzymes, is closely related to SFT, which is short for stimulator of iron (Fe) transport. In other words, UbcH5A is significantly up-regulated in the liver of iron-overloaded patients with hereditary hemochromatosis, as previously published for SFT. Moreover, a complex of UBE2D1 is critical in maintaining KRAS protein stability and propose that targeting such complex may be a unique strategy to degrade mutant KRAS to kill cancer cells.
Full Name
ubiquitin-conjugating enzyme E2D 1
References
  • Zhang L, et al. (2011) The IDOL-UBE2D complex mediates sterol-dependent degradation of the LDL receptor. Genes Dev. 25(12): 1262-74.
  • Tokumoto M, et al. (2011) Cadmium toxicity is caused by accumulation of p53 through the down-regulation of Ube2d family genes in vitro and in vivo. J Toxicol Sci. 36(2): 191-200.
  • Ohbayashi N, et al. (2008) Physical and functional interactions between ZIP kinase and UbcH5. Biochem Biophys Res Commun. 372(4): 708-12.
  • Gehrke SG, et al. (2003) UbcH5A, a member of human E2 ubiquitin-conjugating enzymes, is closely related to SFT, a stimulator of iron transport, and is up-regulated in hereditary hemochromatosis. Blood. 101(8): 3288-93.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait