Быстрый заказ

Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек UBE2D1 Информация о продукте «Клон cDNA»
    Размер кДНК:444bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) with N terminal Myc tag.
    Синоним гена:SFT, UBCH5, UBC4/5, UBCH5A, E2(17)KB1, UBE2D1
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with UBE2D1 qPCR primers for gene expression analysis, HP101309 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11432-ACGRBS15400
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11432-ACRRBS15400
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11432-ANGRBS15400
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11432-ANRRBS15400
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11432-CFRBS13340
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11432-CHRBS13340
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11432-CMRBS13340
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11432-CYRBS13340
    Человек UBE2D1 Gene cDNA clone plasmidHG11432-MRBS5130
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11432-NFRBS13340
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11432-NHRBS13340
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11432-NMRBS13340
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11432-NYRBS13340
    Человек UBE2D1 Джин ORF экспрессии кДНК клона плазмидыHG11432-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
  • Zhang L, et al. (2011) The IDOL-UBE2D complex mediates sterol-dependent degradation of the LDL receptor. Genes Dev. 25(12): 1262-74.
  • Tokumoto M, et al. (2011) Cadmium toxicity is caused by accumulation of p53 through the down-regulation of Ube2d family genes in vitro and in vivo. J Toxicol Sci. 36(2): 191-200.
  • Ohbayashi N, et al. (2008) Physical and functional interactions between ZIP kinase and UbcH5. Biochem Biophys Res Commun. 372(4): 708-12.
  • Gehrke SG, et al. (2003) UbcH5A, a member of human E2 ubiquitin-conjugating enzymes, is closely related to SFT, a stimulator of iron transport, and is up-regulated in hereditary hemochromatosis. Blood. 101(8): 3288-93.
  • Size / Price
    Каталог: HG11432-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.