Быстрый заказ

Text Size:AAA

Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human UBA3 Информация о продукте «Клон cDNA»
Размер кДНК:1392bp
Описание кДНК:Full length Clone DNA of Homo sapiens ubiquitin-like modifier activating enzyme 3 with N terminal Flag tag.
Синоним гена:NAE2, UBE1C, hUBA3
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16320-ACGRBS15400
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16320-ACRRBS15400
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16320-ANGRBS15400
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16320-ANRRBS15400
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16320-CFRBS13340
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16320-CHRBS13340
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16320-CMRBS13340
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16320-CYRBS13340
Человек UBA3 Джин клон кДНК в вектор клонированияHG16320-GRBS5130
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16320-NFRBS13340
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16320-NHRBS13340
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16320-NMRBS13340
Человек UBA3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16320-NYRBS13340
Человек UBA3 Джин ORF экспрессии кДНК клона плазмидыHG16320-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16320-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.