Быстрый заказ

Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TIE1 Информация о продукте «Клон cDNA»
Размер кДНК:3417bp
Описание кДНК:Full length Clone DNA of Homo sapiens tyrosine kinase with immunoglobulin-like and EGF-like domains 1 with N terminal HA tag.
Синоним гена:TIE, JTK14
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10509-ACGRBS22238
Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10509-ACRRBS22238
Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10509-CFRBS20185
Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10509-CHRBS20185
Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10509-CMRBS20185
Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10509-CYRBS20185
Человек Tie1 Джин клон кДНК в вектор клонированияHG10509-MRBS5132
Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10509-NFRBS20185
Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10509-NHRBS20185
Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10509-NMRBS20185
Человек Tie1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10509-NYRBS20185
Человек Tie1 Джин ORF экспрессии кДНК клона плазмидыHG10509-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 also known as Tie1 is an angiopoietin receptor and is an orphan receptor tyrosine kinase that is expressed almost exclusively in endothelial cells and that is required for normal embryonic vascular development. The receptor tyrosine kinase Tie1 is expressed primarily in vascular endothelial cells. The receptor has also been detected in epithelial tumours in breast, thyroid and gastric cancers and in tumour cell lines where it appears as a 45 kDa truncated receptor fragment. Tie1 promotes endothelial cell survival, but other studies have suggested that the Tie1 kinase has little to no activity. Embryos deficient in Tie1 failed to establish structural integrity of vascular endothelial cells, resulting in oedema and subsequently localized haemorrhage. Tie1 is significantly higher in human aortic endothelial cells than in human umbilical vein endothelial cells. Additionally, attachment of cells of monocytic lineage to endothelial cells is also enhanced by Tie1 expression. Collectively Tie1 has a proinflammatory property and may play a role in the endothelial inflammatory diseases such as atherosclerosis.

  • Chan B, et al. (2008) Receptor tyrosine kinase Tie-1 overexpression in endothelial cells upregulates adhesion molecules. Biochem Biophys Res Commun. 371(3): 475-9.
  • Sato TN, et al. (1995) Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature. 376(6535): 70-4.
  • Rees KA, et al. (2007) The receptor tyrosine kinase Tie1 is expressed and activated in epithelial tumour cell lines. Int J Oncol. 31(4): 893-7.
  • Kontos CD, et al. (2002) The endothelial receptor tyrosine kinase Tie1 activates phosphatidylinositol 3-kinase and Akt to inhibit apoptosis. Mol Cell Biol. 22(6): 1704-13.
  • Size / Price
    Каталог: HG10509-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.