After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TXN2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC013726
Размер кДНК:501bp
Описание кДНК:Full length Clone DNA of Homo sapiens thioredoxin 2 with N terminal His tag.
Синоним гена:MTRX, TRX2, MT-TRX
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12557-ACGRBS15400
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12557-ACRRBS15400
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12557-ANGRBS15400
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12557-ANRRBS15400
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12557-CFRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12557-CHRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12557-CMRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12557-CYRBS13340
Человек Thioredoxin-2/TXN2 Джин клон кДНК в вектор клонированияHG12557-GRBS5130
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12557-NFRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12557-NHRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12557-NMRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12557-NYRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмидыHG12557-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Thioredoxin-2, also known as TXN2, MTRX and TRX2, is a member of the thioredoxin family. Tryparedoxins (TXN) are thioredoxin-related proteins which, as trypanothione:peroxiredoxin oxidoreductases, constitute the trypanothione-dependent antioxidant defense and may also serve as substrates for ribonucleotide reductase in trypanosomatids. Thioredoxin-2 / TXN2 contains one thioredoxin domain. It is widely expressed in adult (at protein level) and fetal tissues. Human Thioredoxin-2 / TXN2 is a small redox protein important in cellular antioxidant defenses, as well as in the regulation of apoptosis. Thioredoxin-2 / TXN2 has an anti-apoptotic function and plays an important role in the regulation of mitochondrial membrane potential. Thioredoxin-2 / TXN2 could be involved in the resistance to anti-tumor agents. It possesses a dithiol-reducing activity. Thioredoxin-2 / TXN2 plays an important role in protecting the mitochondria against oxidative stress and in sensitizing the cells to ROS-induced apoptosis. Mammalian Thioredoxin-2 / TXN2 is a mitochondrial isoform of highly evolutionary conserved thioredoxins. Thioredoxins are small ubiquitous protein-disulfide oxidoreductases implicated in a large variety of biological functions.

Ссылки
  • Chen Y., et al., 2002, J. Biol. Chem. 277: 33242-8.
  • Smeets A., et al., 2005, Protein Sci. 14: 2610-21.
  • Wen,S. et al., 2009, Am J Med Genet A  149A (2): 155-60.
  • Choudhary C., et al., 2009, Science 325: 834-40.
  • Size / Price
    Каталог: HG12557-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».