Быстрый заказ

Text Size:AAA

Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TXN2 Информация о продукте «Клон cDNA»
Размер кДНК:501bp
Описание кДНК:Full length Clone DNA of Homo sapiens thioredoxin 2 with N terminal His tag.
Синоним гена:MTRX, TRX2, MT-TRX
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12557-ACGRBS15400
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12557-ACRRBS15400
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12557-ANGRBS15400
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12557-ANRRBS15400
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12557-CFRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12557-CHRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12557-CMRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12557-CYRBS13340
Человек Thioredoxin-2/TXN2 Джин клон кДНК в вектор клонированияHG12557-GRBS5130
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12557-NFRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12557-NHRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12557-NMRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12557-NYRBS13340
Человек Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмидыHG12557-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Thioredoxin-2, also known as TXN2, MTRX and TRX2, is a member of the thioredoxin family. Tryparedoxins (TXN) are thioredoxin-related proteins which, as trypanothione:peroxiredoxin oxidoreductases, constitute the trypanothione-dependent antioxidant defense and may also serve as substrates for ribonucleotide reductase in trypanosomatids. Thioredoxin-2 / TXN2 contains one thioredoxin domain. It is widely expressed in adult (at protein level) and fetal tissues. Human Thioredoxin-2 / TXN2 is a small redox protein important in cellular antioxidant defenses, as well as in the regulation of apoptosis. Thioredoxin-2 / TXN2 has an anti-apoptotic function and plays an important role in the regulation of mitochondrial membrane potential. Thioredoxin-2 / TXN2 could be involved in the resistance to anti-tumor agents. It possesses a dithiol-reducing activity. Thioredoxin-2 / TXN2 plays an important role in protecting the mitochondria against oxidative stress and in sensitizing the cells to ROS-induced apoptosis. Mammalian Thioredoxin-2 / TXN2 is a mitochondrial isoform of highly evolutionary conserved thioredoxins. Thioredoxins are small ubiquitous protein-disulfide oxidoreductases implicated in a large variety of biological functions.

  • Chen Y., et al., 2002, J. Biol. Chem. 277: 33242-8.
  • Smeets A., et al., 2005, Protein Sci. 14: 2610-21.
  • Wen,S. et al., 2009, Am J Med Genet A  149A (2): 155-60.
  • Choudhary C., et al., 2009, Science 325: 834-40.
  • Size / Price
    Каталог: HG12557-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.