Быстрый заказ

Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TVP23B Информация о продукте «Клон cDNA»
Размер кДНК:618bp
Описание кДНК:Full length Clone DNA of Homo sapiens trans-golgi network vesicle protein 23 homolog B (S. cerevisiae) with N terminal HA tag.
Синоним гена:FAM18B, NPD008, CGI-148, FAM18B1, YDR084C
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16425-ACGRBS15400
Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16425-ACRRBS15400
Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16425-CFRBS13340
Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16425-CHRBS13340
Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16425-CMRBS13340
Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16425-CYRBS13340
Человек TVP23B Джин клон кДНК в вектор клонированияHG16425-GRBS5130
Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16425-NFRBS13340
Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16425-NHRBS13340
Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16425-NMRBS13340
Человек TVP23B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16425-NYRBS13340
Человек TVP23B Джин ORF экспрессии кДНК клона плазмидыHG16425-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16425-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.