beta Tubulin / TUBB cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

beta Tubulin / TUBB cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tubulin, beta with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI (6kb + 1.37kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

beta Tubulin / TUBB cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta Tubulin / TUBB cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

beta Tubulin / TUBB cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

CDCBM6 cDNA ORF Clone, Human; M40 cDNA ORF Clone, Human; OK/SW-cl.56 cDNA ORF Clone, Human; TUBB1 cDNA ORF Clone, Human; TUBB5 cDNA ORF Clone, Human

beta Tubulin / TUBB Background Information

TUBB encodes a beta-tubulin isotype that is expressed abundantly in the developing brain. Functional analyses of the TUBB mutants show multiple defects in the chaperone-dependent tubulin heterodimer folding and assembly pathway that leads to a compromised yield of native heterodimers. The mutation at the TUBB locus could be the cause for certain forms of HLA-linked microtubule dysfunction, including immotile cilia syndrome.
Full Name
tubulin beta class I

beta Tubulin / TUBB cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed 正在更新购物车,请稍后