beta Tubulin cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11626-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All beta Tubulin Reagents

CRO Services

Product recommended


All beta Tubulin Reagents

beta Tubulin cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tubulin, beta with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI (6kb + 1.37kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

beta Tubulin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta Tubulin cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

Cynomolgus CDCP1 Gene Plasmid Map 5627

beta Tubulin cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

CDCBM6 cDNA ORF Clone, Human;M40 cDNA ORF Clone, Human;OK/SW-cl.56 cDNA ORF Clone, Human;TUBB1 cDNA ORF Clone, Human;TUBB5 cDNA ORF Clone, Human

beta Tubulin Background Information

TUBB encodes a beta-tubulin isotype that is expressed abundantly in the developing brain. Functional analyses of the TUBB mutants show multiple defects in the chaperone-dependent tubulin heterodimer folding and assembly pathway that leads to a compromised yield of native heterodimers. The mutation at the TUBB locus could be the cause for certain forms of HLA-linked microtubule dysfunction, including immotile cilia syndrome.
Full Name
tubulin beta class I

beta Tubulin cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
beta Tubulin cDNA ORF Clone in Cloning Vector, Ferret FG60059-G
beta Tubulin cDNA ORF Clone, Ferret, untagged FG60059-UT
beta Tubulin cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60059-ACG
beta Tubulin Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60059-ACGLN
beta Tubulin cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60059-ANG
beta Tubulin cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60059-ACR
beta Tubulin cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60059-ANR
beta Tubulin cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60059-CF
beta Tubulin cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60059-NF
beta Tubulin cDNA ORF Clone, Ferret, C-His tag FG60059-CH
beta Tubulin cDNA ORF Clone, Ferret, N-His tag FG60059-NH
beta Tubulin cDNA ORF Clone, Ferret, C-HA tag FG60059-CY
beta Tubulin cDNA ORF Clone, Ferret, N-HA tag FG60059-NY
beta Tubulin cDNA ORF Clone, Ferret, C-Myc tag FG60059-CM
beta Tubulin cDNA ORF Clone, Ferret, N-Myc tag FG60059-NM

beta Tubulin cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
beta Tubulin cDNA ORF Clone in Cloning Vector, Cynomolgus CG90642-G
beta Tubulin cDNA ORF Clone, Cynomolgus, untagged CG90642-UT
beta Tubulin cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90642-ACG
beta Tubulin Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90642-ACGLN
beta Tubulin cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90642-ANG
beta Tubulin cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90642-ACR
beta Tubulin cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90642-ANR
beta Tubulin cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90642-CF
beta Tubulin cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90642-NF
beta Tubulin cDNA ORF Clone, Cynomolgus, C-His tag CG90642-CH
beta Tubulin cDNA ORF Clone, Cynomolgus, N-His tag CG90642-NH
beta Tubulin cDNA ORF Clone, Cynomolgus, C-HA tag CG90642-CY
beta Tubulin cDNA ORF Clone, Cynomolgus, N-HA tag CG90642-NY
beta Tubulin cDNA ORF Clone, Cynomolgus, C-Myc tag CG90642-CM
beta Tubulin cDNA ORF Clone, Cynomolgus, N-Myc tag CG90642-NM

beta Tubulin cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
beta Tubulin cDNA ORF Clone in Cloning Vector, Canine DG70160-U

beta Tubulin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
beta Tubulin cDNA ORF Clone in Cloning Vector, Human HG11626-G
beta Tubulin cDNA ORF Clone, Human, untagged HG11626-UT
beta Tubulin cDNA ORF Clone, Human, C-GFPSpark® tag HG11626-ACG
beta Tubulin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11626-ACGLN
beta Tubulin cDNA ORF Clone, Human, N-GFPSpark® tag HG11626-ANG
beta Tubulin cDNA ORF Clone, Human, C-OFPSpark® tag HG11626-ACR
beta Tubulin cDNA ORF Clone, Human, N-OFPSpark® tag HG11626-ANR
beta Tubulin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11626-NF
beta Tubulin cDNA ORF Clone, Human, C-His tag HG11626-CH
beta Tubulin cDNA ORF Clone, Human, N-His tag HG11626-NH
beta Tubulin cDNA ORF Clone, Human, C-HA tag HG11626-CY
beta Tubulin cDNA ORF Clone, Human, N-HA tag HG11626-NY
beta Tubulin cDNA ORF Clone, Human, C-Myc tag HG11626-CM
beta Tubulin cDNA ORF Clone, Human, N-Myc tag HG11626-NM
beta Tubulin qPCR Primer Pairs, Human HP101479
info info
添加购物车成功! 添加购物车失败!