Быстрый заказ

Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TUBA3E Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC057811
Размер кДНК:1353bp
Описание кДНК:Full length Clone DNA of Homo sapiens tubulin, alpha 3e with C terminal HA tag.
Синоним гена:TUBA3E
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15183-ACGRBS15396
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15183-ACRRBS15396
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15183-ANGRBS15396
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15183-ANRRBS15396
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15183-CFRBS13343
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15183-CHRBS13343
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15183-CMRBS13343
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15183-CYRBS13343
Человек TUBA3E Джин клон кДНК в вектор клонированияHG15183-GRBS5130
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15183-NFRBS13343
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15183-NHRBS13343
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15183-NMRBS13343
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15183-NYRBS13343
Человек TUBA3E Джин ORF экспрессии кДНК клона плазмидыHG15183-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».