After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TTR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000371
Размер кДНК:444bp
Описание кДНК:Full length Clone DNA of Homo sapiens transthyretin with N terminal HA tag.
Синоним гена:HsT2651
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-TTR
Участок рестрикции:KpnI + NotI (6kb + 0.47kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human TTR Gene Plasmid Map
Human TTR ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12091-ACGRBS15396
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12091-ACRRBS15396
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12091-CFRBS13343
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12091-CHRBS13343
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12091-CMRBS13343
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12091-CYRBS13343
Человек Prealbumin/Transthyretin Джин клон кДНК в вектор клонированияHG12091-GRBS5132
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12091-NFRBS13343
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12091-NHRBS13343
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12091-NMRBS13343
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12091-NYRBS13343
Человек Prealbumin/Transthyretin Джин ORF экспрессии кДНК клона плазмидыHG12091-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Prealbumin/Transthyretin, also known as ATTR, Prealbumin, TTR and PALB, is a secreted and cytoplasm protein which belongs to the Prealbumin / Transthyretin family. Prealbumin / Transthyretin is detected in serum and cerebrospinal fluid (at protein level). It is highly expressed in choroid plexus epithelial cells. It is also detected in retina pigment epithelium and liver. Each monomer of Prealbumin / Transthyretin has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internal channel. Prealbumin/Transthyretin is a carrier protein. It transports thyroid hormones in the plasma and cerebrospinal fluid, and also transports retinol (vitamin A) in the plasma. Defects in Prealbumin / Transthyretin are the cause of amyloidosis type 1 (AMYL1) which is a hereditary generalized amyloidosis due to Prealbumin / Transthyretin amyloid deposition. Protein fibrils can form in different tissues leading to amyloid polyneuropathies, amyloidotic cardiomyopathy, carpal tunnel syndrome, systemic senile amyloidosis. The diseases caused by mutations include amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis, carpal tunnel syndrome, etc.

Ссылки
  • Westermark P, et al. (1990) Fibril in senile systemic amyloidosis is derived from normal transthyretin. Proc Natl Acad Sci U S A. 87(7): 2843-5.
  • Colon W, et al. (1992) Partial denaturation of transthyretin is sufficient for amyloid fibril formation in vitro. Biochemistry. 31(36): 8654-60.
  • Hammarstrm P, et al. (2003) Prevention of transthyretin amyloid disease by changing protein misfolding energetics. Science. 299(5607): 713-6.
  • Size / Price
    Каталог: HG12091-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human TTR ORF mammalian expression plasmid, N-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».