After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TSPAN7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC018036
Размер кДНК:750bp
Описание кДНК:Full length Clone DNA of Homo sapiens tetraspanin 7 with N terminal HA tag.
Синоним гена:A15, MXS1, CD231, MRX58, CCG-B7, TM4SF2, TALLA-1, TM4SF2b, DXS1692E, TSPAN7
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14031-ACGRBS15400
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14031-ACRRBS15400
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14031-CFRBS13340
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14031-CHRBS13340
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14031-CMRBS13340
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14031-CYRBS13340
Человек TALLA-1 / TSPAN7 (CD231) Джин клон кДНК в вектор клонированияHG14031-GRBS5130
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14031-NFRBS13340
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14031-NHRBS13340
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14031-NMRBS13340
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14031-NYRBS13340
Человек TALLA-1 / TSPAN7 (CD231) Джин ORF экспрессии кДНК клона плазмидыHG14031-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TALLA-1, also known as TSPAN7, is a member of the transmembrane 4 superfamily Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. TALLA-1 gene is associated with X-linked mental retardation and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. TALLA-1 is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins.

Ссылки
  • Berditchevski F. 2002, J Cell Sci. 114 (23): 4143-51.
  • Castellví-Bel S. et al., 2001, Mol Genet Metab. 72 (2): 104-8.
  • Abidi FE. et al., 2002, J Med Genet. 39 (6): 430-3.
  • Size / Price
    Каталог: HG14031-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».