After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human TSPAN4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000389
Размер кДНК:717bp
Описание кДНК:Full length Clone DNA of Homo sapiens tetraspanin 4.
Синоним гена:NAG2, NAG-2, TM4SF7, TSPAN-4, TETRASPAN
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14245-ACGRBS15400
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14245-ACRRBS15400
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14245-CFRBS13340
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14245-CHRBS13340
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14245-CMRBS13340
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14245-CYRBS13340
Человек TSPAN4 Джин клон кДНК в вектор клонированияHG14245-GRBS5130
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14245-NFRBS13340
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14245-NHRBS13340
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14245-NMRBS13340
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14245-NYRBS13340
Человек TSPAN4 Джин ORF экспрессии кДНК клона плазмидыHG14245-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».