After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human TSPAN31 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC010377
Размер кДНК:633bp
Описание кДНК:Full length Clone DNA of Homo sapiens tetraspanin 31.
Синоним гена:SAS, TSPAN31
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14231-ACGRBS15396
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14231-ACRRBS15396
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14231-CFRBS13343
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14231-CHRBS13343
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14231-CMRBS13343
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14231-CYRBS13343
Человек TSPAN31 Джин клон кДНК в вектор клонированияHG14231-GRBS5132
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14231-NFRBS13343
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14231-NHRBS13343
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14231-NMRBS13343
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14231-NYRBS13343
Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмидыHG14231-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TSPAN31 is a member of the transmembrane 4 superfamily. Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. They mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN31 is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma.

Ссылки
  • Wright MD. et al., 1995, Immunol Today. 15 (12): 588-94.
  • Meltzer PS. et al., 1992, Cell Growth Differ. 2 (10): 495-501.
  • Jankowski SA. et al., 1995, Genomics. 25 (2): 501-6.
  • Size / Price
    Каталог: HG14231-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».