Быстрый заказ

Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек TSPAN31 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC010377
    Размер кДНК:633bp
    Описание кДНК:Full length Clone DNA of Homo sapiens tetraspanin 31.
    Синоним гена:SAS, TSPAN31
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TSPAN31 qPCR primers for gene expression analysis, HP102881 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14231-ACGRBS15400
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14231-ACRRBS15400
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14231-CFRBS13340
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14231-CHRBS13340
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14231-CMRBS13340
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14231-CYRBS13340
    Человек TSPAN31 Джин клон кДНК в вектор клонированияHG14231-GRBS5130
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14231-NFRBS13340
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14231-NHRBS13340
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14231-NMRBS13340
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14231-NYRBS13340
    Человек TSPAN31 Джин ORF экспрессии кДНК клона плазмидыHG14231-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    TSPAN31 is a member of the transmembrane 4 superfamily. Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. They mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN31 is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma.

    Ссылки
  • Wright MD. et al., 1995, Immunol Today. 15 (12): 588-94.
  • Meltzer PS. et al., 1992, Cell Growth Differ. 2 (10): 495-501.
  • Jankowski SA. et al., 1995, Genomics. 25 (2): 501-6.
  • Size / Price
    Каталог: HG14231-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».