Быстрый заказ

Text Size:AAA

Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TRIM63 Информация о продукте «Клон cDNA»
Размер кДНК:1062bp
Описание кДНК:Full length Clone DNA of Homo sapiens tripartite motif containing 63, E3 ubiquitin protein ligase with C terminal Myc tag.
Синоним гена:IRF, SMRZ, MURF1, MURF2, RNF28, FLJ32380, TRIM63
Участок рестрикции:KpnI + XbaI (6kb + 1.11kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human TRIM63 Gene Plasmid Map
Human TRIM63 ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14146-ACGRBS15400
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14146-ACRRBS15400
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14146-ANGRBS15400
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14146-ANRRBS15400
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14146-CFRBS13340
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14146-CHRBS13340
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14146-CMRBS13340
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14146-CYRBS13340
Человек TRIM63 Джин клон кДНК в вектор клонированияHG14146-GRBS5130
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14146-NFRBS13340
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14146-NHRBS13340
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14146-NMRBS13340
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14146-NYRBS13340
Человек TRIM63 Джин ORF экспрессии кДНК клона плазмидыHG14146-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14146-CM
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.