Быстрый заказ

Text Size:AAA

Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TREML2 Информация о продукте «Клон cDNA»
Размер кДНК:966bp
Описание кДНК:Full length Clone DNA of Homo sapiens triggering receptor expressed on myeloid cells-like 2 with C terminal Flag tag.
Синоним гена:TLT2, C6orf76, FLJ13693, MGC149715, MGC149716, dJ238O23.1, TREML2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11655-ACGRBS15400
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11655-ACRRBS15400
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11655-CFRBS13340
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11655-CHRBS13340
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11655-CMRBS13340
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11655-CYRBS13340
Человек TREML2/TLT-2 Джин клон кДНК в вектор клонированияHG11655-MRBS5130
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11655-NFRBS13340
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11655-NHRBS13340
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11655-NMRBS13340
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11655-NYRBS13340
Человек TREML2/TLT-2 Джин ORF экспрессии кДНК клона плазмидыHG11655-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Trem-like transcript 2 protein, also known as Triggering receptor expressed on myeloid cells-like protein 2, TREML2 and TLT2, is a single-pass type I  membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. TREML2 is detected in cultured B cells, T cell leukemia and monocyte leukemia. TREML2 is expressed constitutively on CD8 T-cells and induced on CD4 T-cells after activation. TREML2 is a cell surface receptor that may play a role in the innate and adaptive immune response. TREML2 acts as a counter-receptor for CD276 and interaction with CD276 on T-cells enhances T-cell activation. Murine B7-H3 specifically bound to Triggering receptor expressed on myeloid cells (TREM)-like transcript 2 (TLT-2, TREML2). TREML2 was expressed on CD8(+) T cells constitutively and on activated CD4(+) T cells. Stimulation with B7-H3 transfectants preferentially up-regulated the proliferation and IFN-gamma production of CD8(+) T cells. Transduction of TREML2 into T cells resulted in enhanced IL-2 and IFN-gamma production via interactions with B7-H3. There maybe a direct interaction between B7-H3 and TREML2 that preferentially enhances CD8(+) T cell activation.

  • Mungall A.J. et al., 2003, Nature. 425: 805-11.
  • Clark HF. et al., 2003, Genome Res. 13: 2265-70.
  • The MGC Project Team. et al., 2004, Genome Res. 14:2121-7.
  • Hashiguchi M., et al., 2008, Proc. Natl.Acad. Sci. USA.105:10495-500.
  • Leitner,J. et al., 2009, Eur J Immunol. 39 (7):1754-64.
  • Size / Price
    Каталог: HG11655-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.