After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human TRAF3IP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC059174
Размер кДНК:1878bp
Описание кДНК:Full length Clone DNA of Homo sapiens TNF receptor-associated factor 3 interacting protein 1 DNA.
Синоним гена:MIPT3, MIP-T3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15205-ACGRBS16764
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15205-ACRRBS16764
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15205-ANGRBS16764
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15205-ANRRBS16764
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15205-CFRBS14711
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15205-CHRBS14711
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15205-CMRBS14711
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15205-CYRBS14711
Человек TRAF3IP1 Джин клон кДНК в вектор клонированияHG15205-GRBS5132
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15205-NFRBS14711
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15205-NHRBS14711
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15205-NMRBS14711
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15205-NYRBS14711
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмидыHG15205-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15205-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».