Быстрый заказ

Text Size:AAA

Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TRAF3IP1 Информация о продукте «Клон cDNA»
Размер кДНК:1878bp
Описание кДНК:Full length Clone DNA of Homo sapiens TNF receptor-associated factor 3 interacting protein 1 with N terminal HA tag.
Синоним гена:MIPT3, MIP-T3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15205-ACGRBS16760
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15205-ACRRBS16760
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15205-ANGRBS16760
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15205-ANRRBS16760
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15205-CFRBS14710
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15205-CHRBS14710
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15205-CMRBS14710
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15205-CYRBS14710
Человек TRAF3IP1 Джин клон кДНК в вектор клонированияHG15205-GRBS5130
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15205-NFRBS14710
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15205-NHRBS14710
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15205-NMRBS14710
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15205-NYRBS14710
Человек TRAF3IP1 Джин ORF экспрессии кДНК клона плазмидыHG15205-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.