After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human TRA2A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC017094
Размер кДНК:849bp
Описание кДНК:Full length Clone DNA of Homo sapiens transformer 2 alpha homolog (Drosophila) with C terminal HA tag.
Синоним гена:AWMS1, HSU53209
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14604-ACGRBS15400
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14604-ACRRBS15400
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14604-ANGRBS15400
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14604-ANRRBS15400
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14604-CFRBS13340
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14604-CHRBS13340
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14604-CMRBS13340
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14604-CYRBS13340
Человек TRA2A Джин клон кДНК в вектор клонированияHG14604-GRBS5130
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14604-NFRBS13340
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14604-NHRBS13340
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14604-NMRBS13340
Человек TRA2A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14604-NYRBS13340
Человек TRA2A Джин ORF экспрессии кДНК клона плазмидыHG14604-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14604-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».