Быстрый заказ

Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек TPST1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_003596.3
    Размер кДНК:1113bp
    Описание кДНК:Full length Clone DNA of Homo sapiens tyrosylprotein sulfotransferase 1 with C terminal Myc tag.
    Синоним гена:TPST1
    Виды:Human
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TPST1 qPCR primers for gene expression analysis, HP101142 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11258-ACGRBS15400
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11258-ACRRBS15400
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11258-CFRBS13340
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11258-CHRBS13340
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11258-CMRBS13340
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11258-CYRBS13340
    Человек TPST1 Джин клон кДНК в вектор клонированияHG11258-MRBS5130
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11258-NFRBS13340
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11258-NHRBS13340
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11258-NMRBS13340
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11258-NYRBS13340
    Человек TPST1 Джин ORF экспрессии кДНК клона плазмидыHG11258-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Protein-tyrosine sulfotransferase 1, also known as Tyrosylprotein sulfotransferase 1 and TPST1, is a single-pass type I I membrane protein which belongs to the protein sulfotransferase family. Tyrosine O-sulfation is a common posttranslational modification of proteins in all multicellular organisms. This reaction is mediated by a Golgi enzyme activity called tyrosylprotein sulfotransferase (TPST) that catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to tyrosine residues within acidic motifs of polypeptides. Tyrosine O-sulfation has been shown to be important in protein-protein interactions in several systems. Tyrosine sulfation is mediated by one of two Golgi isoenzymes, called tyrosylprotein sulfotransferases (TPST-1 and TPST-2). A relatively small number of proteins are known to undergo tyrosine sulfation, including certain adhesion molecules, G-protein-coupled receptors, coagulation factors, serpins, extracellular matrix proteins, and hormones. TPST1 is a human tyrosylprotein sulfotransferase that uses 3'phosphoadenosine-5'phosphosulfate (PAPS) to transfer the sulfate moiety to proteins predominantly designated for secretion. TPST1 bears N-linked glycosyl residues exclusively at position Asn60 and Asn262. TPST1 and TPST2 have distinct biological roles that may reflect differences in their macromolecular substrate specificity.

    Ссылки
  • Ouyang Y.-B.et al., 1998, Proc. Natl. Acad. Sci. USA. 95: 2896-901.
  • Ouyang,Y.B. et al., 2002,J Biol Chem. 277 (26):23781-7.
  • Hoffhines, A.J. et al., 2006, J Biol Chem. 281 (49):37877-87.
  • Goettsch,S. et al., 2006, J Mol Biol. 361 (3):436-49.
  • Westmuckett, A.D. et al., 2008, Gen Comp Endocrinol. 156 (1):145-53.
  • Size / Price
    Каталог: HG11258-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».