Быстрый заказ

Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек TPSB2 Информация о продукте «Клон cDNA»
    Размер кДНК:828bp
    Описание кДНК:Full length Clone DNA of Homo sapiens tryptase beta 2 with C terminal HA tag.
    Синоним гена:TPS2, TPSB1, tryptaseC
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with TPSB2 qPCR primers for gene expression analysis, HP100526 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10505-ACGRBS15400
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10505-ACRRBS15400
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10505-CFRBS13340
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10505-CHRBS13340
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10505-CMRBS13340
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10505-CYRBS13340
    Человек TPSB2 Джин клон кДНК в вектор клонированияHG10505-MRBS5130
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10505-NFRBS13340
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10505-NHRBS13340
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10505-NMRBS13340
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10505-NYRBS13340
    Человек TPSB2 Джин ORF экспрессии кДНК клона плазмидыHG10505-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1, and fall into two groups, α and β. β-tryptases appear to be the main isoenzymes expressed in mast cells, whereas α-tryptases predominate in basophils. Tryptase is unique in two respects: it is enzymatically active only as a heparin-stabilized tetramer, and it is resistant to all known endogenous proteinase inhibitors because of the unique arrangement of the active sites. Additionally, tryptase family genes have an intron immediately upstream of the initiator codon which separates the transcription initiation site from protein coding sequence, and this feature is characteristic of tryptases. β-tryptases existing in three isoforms (β1,β2,β3) are released in secretory granules, and have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. It has been reported that β-tryptase selectively cleaves ASM-derived eotaxin and RANTES and abrogates their chemotactic activities.

  • Miller, J.S. et al., 1990, J. Clin. Invest. 86: 864-870.
  • Pereira, P.J. et al., 1998, Nature. 392: 306-311.
  • Pallaoro, M.et al., 1999, J. Biol. Chem. 274: 3355-3362.
  • Pang, L. et al., 2006, J. Immunol. 176: 3788-3795.
  • Size / Price
    Каталог: HG10505-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.