Быстрый заказ

Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

  • Human TPO R ORF mammalian expression plasmid, C-His tag
ПаспортОбзорыСвязанные продуктыПротоколы
Человек MPL Информация о продукте «Клон cDNA»
Размер кДНК:1908bp
Описание кДНК:Full length Clone DNA of Homo sapiens myeloproliferative leukemia virus oncogene with C terminal His tag.
Синоним гена:MPLV, TPOR, C-MPL, CD110, MPL
Участок рестрикции:KpnI (two restriction sites) + XbaI (6kb + 0.99kb + 0.98kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with MPL qPCR primers for gene expression analysis, HP100472 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек MPL Gene Plasmid Map
Human TPO R ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10443-ACGRBS16760
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10443-ACRRBS16760
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10443-CFRBS14710
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10443-CHRBS14710
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10443-CMRBS14710
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10443-CYRBS14710
Человек c-MPL / CD110 / TPOR Джин клон кДНК в вектор клонированияHG10443-MRBS5130
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмидыHG10443-M-NRBS14710
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10443-NFRBS14710
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10443-NHRBS14710
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10443-NMRBS14710
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10443-NYRBS14710
Человек c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмидыHG10443-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD110, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs. It is expressed at a low level in a large number of cells of hematopoietic origin. C-MPL is homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. Thrombopoietin is the ligand for c-mpl. It was shown to be the major regulator of megakaryocytopoiesis and platelet formation. Defects in c-MPL are a cause of congenital amegakaryocytic thrombocytopeniawhich is a disease characterized by isolated thrombocytopenia and megakaryocytopenia with no physical anomalies. Defects in c-MPL also cause thrombocythemia type 2 and myelofibrosis with myeloid metaplasia.

Size / Price
Каталог: HG10443-CH
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

Contact Us
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.