Быстрый заказ

Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек TOR3A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC018292
    Размер кДНК:1194bp
    Описание кДНК:Full length Clone DNA of Homo sapiens torsin family 3, member A.
    Синоним гена:ADIR, ADIR2, TOR3A
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TOR3A qPCR primers for gene expression analysis, HP101997 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13289-ACGRBS15400
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13289-ACRRBS15400
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13289-ANGRBS15400
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13289-ANRRBS15400
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13289-CFRBS13340
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13289-CHRBS13340
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13289-CMRBS13340
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13289-CYRBS13340
    Человек TOR3A Джин клон кДНК в вектор клонированияHG13289-GRBS5130
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13289-NFRBS13340
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13289-NHRBS13340
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13289-NMRBS13340
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13289-NYRBS13340
    Человек TOR3A Джин ORF экспрессии кДНК клона плазмидыHG13289-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».