After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human TOR3A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC018292
Размер кДНК:1194bp
Описание кДНК:Full length Clone DNA of Homo sapiens torsin family 3, member A.
Синоним гена:ADIR, ADIR2, TOR3A
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13289-ACGRBS15400
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13289-ACRRBS15400
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13289-ANGRBS15400
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13289-ANRRBS15400
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13289-CFRBS13340
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13289-CHRBS13340
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13289-CMRBS13340
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13289-CYRBS13340
Человек TOR3A Джин клон кДНК в вектор клонированияHG13289-GRBS5130
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13289-NFRBS13340
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13289-NHRBS13340
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13289-NMRBS13340
Человек TOR3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13289-NYRBS13340
Человек TOR3A Джин ORF экспрессии кДНК клона плазмидыHG13289-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13289-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».