After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human TOM1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC046151
Размер кДНК:1482bp
Описание кДНК:Full length Clone DNA of Homo sapiens target of myb1 (chicken) DNA.
Синоним гена:TOM1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15222-ACGRBS15400
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15222-ACRRBS15400
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15222-ANGRBS15400
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15222-ANRRBS15400
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15222-CFRBS13340
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15222-CHRBS13340
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15222-CMRBS13340
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15222-CYRBS13340
Человек TOM1 Джин клон кДНК в вектор клонированияHG15222-GRBS5130
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15222-NFRBS13340
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15222-NHRBS13340
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15222-NMRBS13340
Человек TOM1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15222-NYRBS13340
Человек TOM1 Джин ORF экспрессии кДНК клона плазмидыHG15222-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15222-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».